Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P136C06
Clone ID P136C06
Vector ROSAbetageo0
Project ggtc

Sequence tag P136C06
Sequence
GCTCGTTGCAGCTCTAGGCTCTCGGNNAGAGGTGGCTGTGAGGGGCCCCGAGCTCGCGGCTCTCCGGATTCCGAAGCCTC
GGGTTGCTTCGAGGGAGGAGAATCTGCTGCGGCCGATCCCGCGACACTACTGACCTANNNNCNACGTGCCCGCCGCCGCT
GTTGGTTGGAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP136C06
Sequence
AATTTACAGATACTCATAGAGTGCCCTTAGATTCTATGCAGCAGTTTTTCCTCTGTAGCAGAATTGTCATTACACATTAT
GAATATTAGAAGTTATTTTCTAAACTGCCTTAATTTGTCCTGCTTTTCTGTTGAGTGGACATGAGGATGATGAATGACAT
CTTTGAACGTTTTACACTGAAGCACAAGTTGGATTGCTTGTGAACAGAAAGAGGGTGGAACAGAGTTGAGAGTTTGGACC
TGGTTACTACACTGGCAGATGTGTGTTTGATAGCTGATAAAGCAAACCTGTGTGTTTTCCCCAAACTGTTAGCAAAAAAT
TGGGTTTTCGTGTGTCGTGGTTTATTTTAATCATCTCTGGATTATCTATCCAAAAATTGTTACTGTGCTAACATTGGGGA
TATTTCTTGCTGG
Sequence Type genomic DNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92509974..92510386 391
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]

 
Come back to gene ENSMUSG00000029405


For any suggestions or comments, please send an email to unitrap@crg.es