Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P136C01
Clone ID P136C01
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP136C01
Sequence
AATTTAGACCCAAACTACCTTCCTCTCTCTTCTCTCTTGGGACTAGTTAAAGTCAGGGGACTCTCAGCTCCTGTCGTGTG
CAATAATCTTTTCTTTTTCTGCCTAGTTCCTGTCTTGAGTTTTGTCCTCCC
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165702418..165702548 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


SPLK-Sequence tag 3SP136C01
Sequence
GCTCTCCCAACAGGACTCCATCTTACCCCAAGCTTCCAGGCTGGAGGCTGNNNTTTCTGACACAGAGCACGGGACGCAGA
CAGCACAGCCTTCTCAGCTGTTTTCCTCTCTTGCCTTCCCAATGGAAAATTCCAC
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165702271..165702404 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es