Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P136B08
Clone ID P136B08
Vector ROSAbetageo0
Project ggtc

Sequence tag P136B08
Sequence
TTATTCCCCTCGCGGACTNGACNNNNGCNNNTGGGGTGCNNGAGTCTCCGCAACTCGCACATCAGGANNGAAGATCCTCC
TAGGCAGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP136B08
Sequence
AATTTTCTAAATGTGTGTTATTTTATTTTTCTGGTATTTGAATACAGTCACATGTTAAGCATGAAAAAATATGTGAAGCT
TCATTTTGTTTGGGGGAAGAATTATGACTTTATAAATCTCAGGTGGTATATTGATTAAAAAAAAATCTTCATTGATTCTG
GCTTCTTAGGGTCTAGCTACTTAGATCAGGGCTCAACAGCTTTAATGCTAAAACATTCCATATTATGTACTTTGTACACC
TACGTGGATCTTGATTGTGTCCTTATTAGCATGAACATTTCAGTAAAATGTGTAATA
Sequence Type genomic DNA
Unitrap ID UNI20489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17742570..17742866 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037369 (Utx) NM_009483 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome Gene [Source:MGI (curated);Acc:Utx-001]

 
Come back to gene ENSMUSG00000037369


For any suggestions or comments, please send an email to unitrap@crg.es