Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P135H07
Clone ID P135H07
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SP135H07
Sequence
GAGGAGGATGGCCCGATTCCATTCTCTGGGCTGAGGCTTGGCTGTGCGGCACCTTCGTGTCAGGCAGTTAGAGATCTCTC
TACTTGGACGAAGTGGTTTTAGGTAGTACTTTGTTTTGTAGTTGGGACTCTTAGGGTACATTTCCGGTCGTCTTCGTCTT
TCCACCTTGGTTTTCAAATGTTTCCGTGCGTTTGTGTGCGTTTTGGGTTAGAATCTTGTTGGG
Sequence Type genomic DNA
Unitrap ID UNI12966

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 151700516..151700738 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028936 (Rpl22) NM_009079 ribosomal protein L22 Gene [Source:MGI (curated);Acc:Rpl22-002]

 
Come back to gene ENSMUSG00000028936


For any suggestions or comments, please send an email to unitrap@crg.es