Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P135C12
Clone ID P135C12
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP135C12
Sequence
AATTTATGGCCACTTCCTGTAATCTTTTGCCTGCTGGGCAGTGCTTTCCCGACTCTAGGCTGTGGGTTCCTGCCCTGTTC
CAGGCATGCGGACTTACTCCTTAACGGTCTCAAGTTGCTTTTGTTCTTTTCTGTGGATGGCACTGAGCACAGACCCAGTG
AGTCTTACTGATTCTGTTGCTGTGTGTAGGATGCTGCAGATG
Sequence Type genomic DNA
Unitrap ID UNI29476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88708971..88709172 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]

 
Come back to gene ENSMUSG00000018428


For any suggestions or comments, please send an email to unitrap@crg.es