Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P135B07
Clone ID P135B07
Vector ROSAbetageo0
Project ggtc

Sequence tag P135B07
Sequence
GAAAACAAGCTTCCTGACCGTGGCTTCCTCCTGAACAGGCAAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97837233..97837276 40
 
EST/CDNA Est Name
  CD546468.1


SPLK-Sequence tag 5SP135B07
Sequence
CTTAACCATCCACCTACAAACTCAGAGGTGGGCCTTACCCAACTGTAAGCAAATCTTTTACAGGGACTAGAAAGGGCTTG
CTGAGCACTGCCGAGGACCACGTAGTTTTGGGTTGTAGTAGCTTTTCAGTTATTTCATTATTGGCACACTCAACTTCTTG
GCTCTCAGAGGAAGGTGAGTGTTTGGGTACGTCTAGGGCATCTAGGACTTAGGGCCTGTGGAGGACATGGGGAGAAGAAA
AAGTTAAGGCAAAGATGGGTTGTGGTGGCGTAGAGCAGAGCTTGTGTTGGTTAGGGAACGAAATCAGGGAGACAAGGGAG
GAAACACTCATGGCTAGAAACTGGCGTTGTGTGTGAGGTTGAGAGAGCATTACTGAGCGCTGCCTAGAAACCTCAGGTGA
TCTTGAGGAAGAAACCATGTGAGTCAGGGCAGGGTCATGACTTGATGGGTTGAGAT
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857190..97857646 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es