Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P135A11
Clone ID P135A11
Vector ROSAbetageo0
Project ggtc

Sequence tag P135A11
Sequence
TTTTTTCNNNTAGCACAGATANNNTCTGCGATNNNGNNGGGTGTTCCTCTGCCCATGAGACTACGCAGTCGCAGGAGCCA
GGGGTGGAAGATGTCGGGAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP135A11
Sequence
GGGGCTNNGGACCTTTTGGAGCGGGCCTGCCGCTCTCCCTTCTCTCTCCGTGGTCCCTGAGCCTCCGGTAGTCCCCATAC
ACCCACGCTTGCTCCACCACGTTGCCTGTAGGCACTGCGGGACATTTCGGGGTCGCCTGGAAGACCCACCCCACTGCGAT
CCCTTCCTTGCTGTCCCTGCGCCCTGCTCCCCCTCGGGTGTGCCTTGCCCACGCCGCGATTTCTTCCCGCGGGCATCCTT
AGTTCCCGCCTTCTTTTATTTTTGGCTAATGCCGATATTGATGCAATCAGCAGGCATGCCTTCATCTTCCATGCGATTCC
GGGTTTTGTGCCAGGCTTCGGACACAAGATGAATTACCCCGAAACAAATATACAGTTCTCACTTAAAAGAGTGCT
Sequence Type genomic DNA
Unitrap ID UNI14694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30142149..30142544 388
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052533 (Nup188) NM_198304 nucleoporin 188 Gene [Source:MGI (curated);Acc:Nup188-001]

 
Come back to gene ENSMUSG00000052533


For any suggestions or comments, please send an email to unitrap@crg.es