Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P135A03
Clone ID P135A03
Vector ROSAbetageo0
Project ggtc

Sequence tag P135A03
Sequence
ATTATTATTTCTACNNNCACAGCCACAGCGGGCGGGGGCGNNGCCATCACCAGCAGCCTNNNCAATACCTGCAGCATGGA
GCCGAGGGCAGCCCCAAGGCCCAGCCCAAGCCGCTGAAACATGAGCAGAAACACGCCCTCCAGCAGCACCAGGAAACGCC
GAAGAAGAAAACAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP135A03
Sequence
ACAGCAGCCTAGAAACTTAGGAATTATGTAACTGT
Sequence Type genomic DNA
Unitrap ID UNI5210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77501963..77501997 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037857 (Nufip2) NM_001024205 nuclear fragile X mental retardation protein interacting protein 2 Gene [Source:MGI (curated);Acc:Nufip2-001]

 
Come back to gene ENSMUSG00000037857


For any suggestions or comments, please send an email to unitrap@crg.es