Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P134H10
Clone ID P134H10
Vector ROSAbetageo0
Project ggtc

Sequence tag P134H10
Sequence
CANNNNTCTGNNNCCTGAGGCTCGTCCCCCGGGGTGGGNNNCGCGCCGAAAGCTGGAATCTTTCCTGGCAGAAGCTNNNT
GTTGGGCACAGAGGAAGGACAGGAGAGAGAGCCGAGACGTAAGGACCACTGTACCGAGTTTCTTCCTTCCGTGAATGAGA
AGATACCAGAGATAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP134H10
Sequence
ACCTACACACGACCTGCCCTTCCTGGCCGGGAAGCCTAGCAGGATGGCCCTGAGAGTGTTGACTTGGGCCTGGTTGTCAT
TGTTTGTGAGTGTGGAAAGTACCCTGAGGGATTACACTTTTCCTGGACAGGTACAACAACAAGGAAATAGGCCGAGTCAG
TCCTG
Sequence Type genomic DNA
Unitrap ID UNI17236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59514299..59514463 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es