Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB659
Clone ID XB659
Vector pGT0pfs
Project baygenomics

Sequence tag XB659
Sequence
CCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTTGGAGAATTTGAGAGGTGGGCCCAACATCATCACACTTGC
AGACATTGTAAAAGACCCTGTGTCACGAACCCCTGCCTTGGTTTTTGAACATGTAAACAACACAGACTTCAAGCAATTGT
ACCAGACGTTAACAGACTATGACATTCGATTTTACATGTATGAAATTCTGAAAGCCCTGGATTATTGTCACAGCATGGGG
ATTATGCACAGAGATGTGAAACCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTTCGGCTAATAGACTGGGGTTT
AGCTGAGTTTTACCATCCAGGCCAAGAGTATAATGTCCGAGTTGCTTCTCGATATTTCAAAGGTCCAGAGCTACTTGTAG
ATTAT
Sequence Type mRNA
Unitrap ID UNI10157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152083114..152089026 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es