Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P134G05
Clone ID P134G05
Vector ROSAbetageo0
Project ggtc

Sequence tag P134G05
Sequence
CCAGAGGAAAGCGGAAGAGAGTTGATGTGGAGGAGTCGGAGGCGAGCAGCAGTGTTAGCATTTCCCACTCTGCCTCAGCC
ACGGGGAACGTGTGCATTGAAGAGATAGATGTTGATGGGAAGTTTATTCGCTTGAAGAACACTTCTGAGCAGGATCAACC
AATGGGAGGCTGGGAGATGATCAGAAAAATTGGAGACACATCAGTCAGTTACAAATATACCTCAAGATATGTGCTGAAGG
CTGGCCAGACTGTCACA
Sequence Type mRNA
Unitrap ID UNI10964

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56900415..56902969 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024590 (Lmnb1) NM_010721 lamin B1 Gene [Source:MGI (curated);Acc:Lmnb1-001]


SPLK-Sequence tag 5SP134G05
Sequence
AATTCAGGTTAGAACTTCTCTAAAGTATAGAGAGCTTTGACATCTCTTTGAAAACAGTAGGTGTTAATTTTGTAATAATG
AGTGAAAATGAGAACAAATATCCTAACTGCTCTATTCTTTAGTAATTATAGTGAGAGAAGATTGCTTAGTTCTATTATAA
GTCTAGGGAAACTGCATAGTGTATTTAAGTTTGGTATTTTACTTCAGAAGGCTTAGATTAGAATCTTTGTCTCATGATGT
GGAGCCGTTATGCCAGTCATCCGCTTT
Sequence Type genomic DNA
Unitrap ID UNI10964

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56905195..56905461 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024590 (Lmnb1) NM_010721 lamin B1 Gene [Source:MGI (curated);Acc:Lmnb1-001]


SPLK-Sequence tag 3SP134G05
Sequence
AAGCGACTGCTCCTGGAGGTGTTTTTACAGAAGAACGCATCCCAGGAGATAGCGCAGTACATTTTTTCTTTAGTAGATTG
TATTGCGTGTGATCAGATTTTTGGGACATGGTAGTGAGGGAGATTTCCCAATGACATTGTTCAAGGCGAATTGCAAGGAT
CGGTCTAAAGATTCAACAGAGATGAAAGTACTATGTATGCCTTTAAAAAGG
Sequence Type genomic DNA
Unitrap ID UNI10964

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56905489..56905699 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024590 (Lmnb1) NM_010721 lamin B1 Gene [Source:MGI (curated);Acc:Lmnb1-001]

 
Come back to gene ENSMUSG00000024590


For any suggestions or comments, please send an email to unitrap@crg.es