Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P134E05
Clone ID P134E05
Vector ROSAbetageo0
Project ggtc

Sequence tag P134E05
Sequence
TCCCATTCCCAGTTTTTGTTTGTTGCTCCCTTGCTGGCCGTCAGAAAAAGGCCTCCAACTTTTTTACCCAAGAAGAGGTT
CTGTTTTACCAATTTTAATTAGGTGGAGCCAGAAAGAAGATTTTATGACAAGATGAACGGCCCTGTGACCTCCCCGCCCG
CCAGGAGAATGGTGCCAGCGTGATCCTCCGAGACATTGCAAGAGCCAGAGAGAACATCCAGAAATCCTTGGCTGGA
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP134E05
Sequence
GTCGAGGGCCTTAGTTCACCTATTAAATCTGCCTTACTGTGTGAACTAACATGCTAAGCTTTGGAGAGTACAGCCATTTC
TAGGGCACTATTCTATAGGTAGTCAAAAAGTGCATAGCCTTTTTAAAAGGNNGCGCACAAACACCTGACCCCTTCTTGGT
CCTACCTGACTTCTGTTCTCATCCTACCATTCCCTAGTCCAAAACTCGTGATC
Sequence Type genomic DNA
Unitrap ID UNI29461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 75728605..75728816 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055762 (Eef1d) NM_023240 eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:MGI (curated);Acc:Eef1d-006]


SPLK-Sequence tag 3SP134E05
Sequence
CAGGCACATTGAGTTCAGCCCCCCCCCTCCCCCCAAAAGAAAAGCTGGGTCAAGCTCAGTAGCTATTTCCTGTCTTGCNN
GAGCTNNNCTGTCCCTTGCCAGGTCCTTTGTGTTGTTTAAGTCCTGCTGTAGAGTGGGAAAGCCCCCAGGTGTTTTGGAA
ATAGCCCTTGCTTTCCAGCCTAGCCTCCATTCACATATTCTAGTCTTTTGAACTTCGTGGCCTTGCTTGCAGGGAAACTA
AAGGTACCTCCCGCTCTTCCAAATCATACCATAGGGCTCTGTTGTCACACCAAGTTAAAAT
Sequence Type genomic DNA
Unitrap ID UNI29498

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 75728269..75728569 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055762 (Eef1d) NM_023240 eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:MGI (curated);Acc:Eef1d-006]

 
Come back to gene ENSMUSG00000055762


For any suggestions or comments, please send an email to unitrap@crg.es