Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P134C10
Clone ID P134C10
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP134C10
Sequence
CACGGGCTCGCTCGTTCTCTTTCTGCCGCCATCTTGGTTCCGTGATCTNNNCACAGTAAGTGNNNCTGGCGTCTCTGCTT
TCCATCCGTAGNNNTCCTCGCCTGCTGCCAGCTTTGCGGCACCGGGCATTTAAGTTTAACATCGCTGGCGGCTCTGTGGG
GCTCAGCGTTCTTAGCTCGCCCCCGCGCCTGCGGGCAAAATGGGGTCTGCGCTTTGGGTCCCAGCAACAGCAGGACAGGA
GGGCCCCGGGTCCGGCTCCCGGTTTAAGGCGTGGGGACGCGGGAACCATTGCGGTGGAGCCGGAGAGGCTGGGCGCGTCT
GCAGTTGGGAAGGGCGCCACGGGGATCTGGACGAGGAGGTTAAGGGGGTCACAGCCTTAACTCGCAGCGTCGCTGGTCCT
GGGGCACCCCGTGTTCTTCTTGCTCTGCGAAGTGGTCCTTAGCGAGTCGGGGGGTCCCAGACTCAGCGGCGTGAAGGTGG
GGACCGGAAGGGGGCCCAGAGTAGCGCCTGGACGCTCACGGTTAGGAGTCAGACCTTGGGATTGCTGCCCTTGTGGGATC
GATCGGAAGAGTGACAACGAGGATCTGGCCAGGGCCGAAGTCAAGCTCTCTGCTAAGTGAAGCGGNNCCGCGAGGTCAGA
TCCTCTGAGCAGGCGTCCCAGGGTCGTGGCGTAGTTTGACTCCGTTTCCAGT
Sequence Type genomic DNA
Unitrap ID UNI5829

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127472685..127473374 658
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]


Sequence tag P134C10
Sequence
AACACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCACACAC
AACTAAACCACCAAAGCTAANNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTCTTTTTTCCTTCTCAACCGCCACCAACGACANNCCAAAAAAAAANNA
NNNNNNNNNNNNNNNNNNNNNNCCCCCCACAAAAAANNNNNNNNNNNNNNNNNNTCCTTCTGCAACATTCGTGGGTCACG
GGCTCGCTCGTTCTNNNNNNNNNNNNNNNNNNNNNNNNTGATCTCCGCACA
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es