Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P134A01
Clone ID P134A01
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP134A01
Sequence
AATTTTTCTGGACATGAAGAGAGAATTAAACCTNNNGTTAGAATATTTCTAAAAATACTTTTGCAAAGAGTATTTATATT
TAAGACTTTCCTGATAGATACTCTTAGGGTCCCCAACATTATCTGTGTTTTTAGAAATGTTCACTGCTGTCATCAAAAGA
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97856669..97856828 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


SPLK-Sequence tag 3SP134A01
Sequence
AGCTTATGTTGGTTAGGGAACGAAATCAGGGAGACAAGGGAGGAAACACTCATGGCTAGAAACTGGCGTTGTGTGTGAGG
TTGAGAGAGCATTACTGAGCGCTGCCTAGAAACCTCAGGTGATCTTGAGGAAGAAACCATGTGAGTCAGGGCAGGGTCAT
GACTTGGATGGGTTGAGATAATTGTTTCTCTGAG
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857468..97857661 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es