Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P133H08
Clone ID P133H08
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP133H08
Sequence
AATTCAACGAGCTACTAAAAGTCCCAGCCATTTCTTCAGTATTTTGGGTCAAACCGGATTATATAAGTGGTTA
Sequence Type genomic DNA
Unitrap ID UNI23500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112278334..112278405 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]


SPLK-Sequence tag 3SP133H08
Sequence
ATTTTTGTCTCTTTCCCCTCTCCTGTTTGTGGTCTTCAGCCAAAACTGAAAGATATGTTTGATTTGTGTACCAAGTAGTT
TCAGCAGGTTCAAATTACTGTTNNCATATTGCTGAAGCTTTGTGCCAGTACTTGATACCTTAATCAGAAGAGCGAACAGT
TATAGACCTTCNACNNTTTTCATATTACCACGTTACAGCACATTCTAAATGAAGACATTGAAAGAATACAGCGTTTTTTT
CTTTTTATCTTTTATTTACTTGGGAATGTAAGATGTTCCATTTTCACACCAGCATGGTAGTATTGAGATAGCTATTTGTC
TATACACGCTGATGTTTAGAAGTAATCTTCAGATGTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es