Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P133G07
Clone ID P133G07
Vector ROSAbetageo0
Project ggtc

Sequence tag P133G07
Sequence
TGGTGCGGAGCGTGTCGGCTTCGAGCTCCTCGCAAAANNNGTGGCGTCGCGCTAGGNNNGCGCGGAGCCTCTGTAAGGAA
GGCGGGAGCTTGACAGCTTCAGGAAAGGCCCGTAGCGGTGACAGCGACCCGGAGTCATGAGCGACAGCGGCGAGCAGAAC
TACGNNGAGCGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP133G07
Sequence
AATTTGTGGAAAGCTATACCGCTTAAGTCCAAATGTTGAGATCT
Sequence Type genomic DNA
Unitrap ID UNI2374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22258523..22258566 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022858 (Sfrs10) NM_009186 splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]


SPLK-Sequence tag 3SP133G07
Sequence
GATTCTTTTATATGTTTCAGTTAACGCCTGTTCAACTGAACTAGGGTTTTTGCTGAAGTATATATAGTAGCGTCCCTTAA
AAGAAATGGGTCAGACAAATGAAATGAGAGCTAATTCAAAGTGTGATAGTAGCTGGTATTTGTGTCTTTTATCTTTAGTT
TATTACAATGATTTTAAAGTAAATATTGTTTTCTTCTAGTGTGCTACTCCAACTGAGGAAAAAAACCACACAGTTCCTGT
CTATGTTTTGACTGATTATATATAGTTAAGTGATTAGCATAATGCTAATACCAAGCACACACAATCCACAAAAAACCAAT
AGCTGTCTTTACCATGCAGAATATTAAATAAAGATTATCATCTTAAAGCTATGGCAAA
Sequence Type genomic DNA
Unitrap ID UNI2374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22258123..22258503 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022858 (Sfrs10) NM_009186 splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]

 
Come back to gene ENSMUSG00000022858


For any suggestions or comments, please send an email to unitrap@crg.es