Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P133F12
Clone ID P133F12
Vector ROSAbetageo0
Project ggtc

Sequence tag P133F12
Sequence
AAGACCCCCCGCGACACCAAACCCTACACCAACAGTGCACTCNNCCTAACNACGCCAAACNNACCGAACCCGACCACCCC
ACACAANNNNCCACCAGGCCANNCCNNCCCCATACACCATCAACACAACGCACTCATCAAGAACACAACCCCCCCGCCCC
TACCCGCACCTCCACACANNAGCCNNCCCCACNNGCAACACTCGCCGCCCCATCACACTCACGACCCCGCCGACCAATCC
CCCCACGCTTACCACCACAACAACACGCCGTCNNCCCTACCNNACAACAAGCGACACGCAACCCNACAAAACACACCAAN
NACGCAGCAGCCACCNNCCAAACCCTCNNCACGGAACGANNCACACCCACACACAACCCCAATACCCCTCCCNNCCCTAA
TCCCANNACCAACGCCGCACGCTCANNNNCACTCCACAACACCCGNNCGANNAAACAGACAANNTGAAAAAAAGAATTCA
ACCTCCCCCACCCCCGNNATTCCGCGCTTACGGTCGTCCCCCACCNNCCATCCNNATCCGATTGACCCNNNCTCAACTAC
AAAANNCTNNCAGCCCCGCACACACNNANNNACTNNCTCACNNCNNNACCTAAAACTNNCAACTTTCTAAAAAGANNACG
CCATACACTCTNNAGGAGGANNGCNNNGTCTGGGACACGGGTCTACGTGGAATTTGATGACCTTGAGTGGGATAAACGGG
AGTGGGTTAGAGTTTATGAAGATTTTTCAACTTTCTTGGTGGAATATCACTTAATCTGGGCCAAAAGGAAGGACCCTAGC
CAGACTCAGGGATCAAAGAGCAGACAAATTCAGTGGCCTGCACTG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66620654..66620819 166
NO GENE  


SPLK-Sequence tag 5SP133F12
Sequence
AGCCTTAGGAATTGAGGTCACTGTCTTTTATAGTTCTAGGCTCAGTGTTCTTAGTTTTAGTATTTTTAAAACTGTTTAGA
AAGAGGTTTTCTGTGTTGACGATCATTTATAA
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649118..66649229 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es