Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P133F10
Clone ID P133F10
Vector ROSAbetageo0
Project ggtc

Sequence tag P133F10
Sequence
CCTGAGCTGCCAGTCCCAGTTTTTGTTGGTTGCGTCCTTGCCGGGCGCCAGAAAAATGCCTCCAACCTTTTTAGGGCATG
AGAAGTTCTGTTTTGCCAAGTTTAATTAGGAGGAGGCAGAAAGGAGTTTCTATGAGCAGGATGACCGGGCCTGTGCTCTC
CCTGCCGCCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP133F10
Sequence
AAGGTGAAGCCAGAGGTTGACCCTAGCCATGCTGACCTAGCCACTCTTTCCCATCTCAGCAGAAAAATGGCTACAAACTT
TCTAGCGCATGAGAAGATCTGGTTTGACAAGTTTAAATATGATGATGCAGAAAGGAGATTCTATGAGCAGATGAACGGGC
CTGGAGCTCCGGCTCCCGCCAGGTAAGGACTATACTCGGAACGGGGTGGGCTAGA
Sequence Type genomic DNA
Unitrap ID UNI29500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 75731529..75731744 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055762 (Eef1d) NM_023240 eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:MGI (curated);Acc:Eef1d-006]


SPLK-Sequence tag 3SP133F10
Sequence
GGCTCCTGGGGCGCTTCTGCTGCTAGCTCCTGATCTAACACCTGTGCCACCTGGGGGCAGCAAGCAACAGGTTGTCTCAG
GGTGGTGTGTGGCCCTGGCCTCCATCACCTTGTGCTTGTCACTGTCTTGGGAGCTTTCGTTCTGTGTAATACACTCCTCT
TCTTTATATTGCGATCTTGCTTTTTGAGTTGAGGGTTCTTGGGGCTTTTGTTTTTCTGTGT
Sequence Type genomic DNA
Unitrap ID UNI29500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 75731290..75731510 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055762 (Eef1d) NM_023240 eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:MGI (curated);Acc:Eef1d-006]

 
Come back to gene ENSMUSG00000055762


For any suggestions or comments, please send an email to unitrap@crg.es