Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB700
Clone ID XB700
Vector pGT0pfs
Project baygenomics

Sequence tag XB700
Sequence
AACACAGATGGCAGCATGCTCTTCTCAGCGTCGACAGACAAAACTGTGGCGGTGTGGGATAGTGAAACTGGGGAGAGAGT
GAAAAGGCTAAAGGGGCATACTTCCTTTGTGAACTCCTGTTACCCAGCCAGGCGGGGCCCCCAACTTGTCTGCACTGGCA
GTGACGATGGTACAGTTAAGCTTTGGGACATCCGGAAGAAAGCAGCTGTCCAGACATTTCAGAACACAGTACCAGGTGTT
GGCTGTGACCTTCAATGACACGAGCGATCAGATTATCTCTGGTGGAATAGATAATGACATCAAG
Sequence Type mRNA
Unitrap ID UNI10161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130045434..130055415 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074088 (Wdr57) NM_025645 WD repeat domain 57 (U5 snRNP specific) Gene [Source:MGI Symbol;Acc:MGI:1913835]

 
Come back to gene ENSMUSG00000074088


For any suggestions or comments, please send an email to unitrap@crg.es