Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P131H02
Clone ID P131H02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P131H02
Sequence
CAAAGAATAGTAAAGAAGANTAATTGGCCGTAAAGACAGGCTGAGAAACCCAAGGGAAAAAAAGAAGGCTCGGGCCTTTC
AGCCCGGGAAAAGGAACCAAAGTGGCTCTTGTTAGNNGNAGAGGAAGATGGCAAGGAANNNTCTGGAGTAGTAGCNNNGA
AGAAGATGAAGAGGAGCAAGAAGGAGGCTTGGGTCAGAGAATGCAGGAAGAAGAAGGAAGATGAGTTGTGGGCCAGCTTC
CTTAATGATGTAGGACCAAAGTCAAAAGCAGNNNNAGGTTCACAAACTAAGGTAGCCGAGGAGACTGAAGAGATTAGTTC
GAATAANNNGTTGGTCAAAGCAGATGAGCTGGATAAGCCTAGAGAATCAGAAAAGGTGAAGATTACCAAGGTGTTTGGCT
TCGCTGGCGAAGAAGTAAGGGTGACTAAGGAAGTAGATGCTGCGTCTAAGGAAGCGAAGTCTTTCCTCAAGCAAACAGAG
AGAGAAAAACCGCAGGCTCTTGTCACTTCACCAGCGACACCACTCCCTGCTGGGTCAGG
Sequence Type mRNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114354770..114365891 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


SPLK-Sequence tag 5SP131H02
Sequence
TGCACATACATACACACAAATAAATGTAACTTTAGTTTTTTTTAAACTGTAAAGAATTATTTTTGT
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114339302..114339367 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]


SPLK-Sequence tag 3SP131H02
Sequence
ATACATGTTAATTTTAAGAAAGAATTTTTCCCCCAGTTTCCTGTTTTCCTAGTTAACATTAGATCACAAAACTGGGAGTA
GAGTTAGCATGTCTGTGGGATTTACATTAAAACCCATGTGCTTAGTGTTTCCAGCCTCTTCCTACTGGATTGGCCTTGTT
GTACTTAGAGAACACTGAAACACTCTAAGGACCCCGCACTGCCTTTCCTTCTCTGTTCATTTGTAGCCGTGTTCGAGTTA
CTTTACTGGTCCTCCATTAGCTAGCGTTCCTATTGTCTGAGAGGGCAGTCCAAACAGGTTACTGTGGTCACAGTCACTTC
TCTCTGTACTCTCCCGTCATAGAAATACATTTGACCTTGCTGTTCAAGCACATAAGCTACTGCTTTATGGCATAAGCTCT
TTTTGAGATTAGAGTAACTCTACACATTGAAAACCTGAGTACTTAAGATAGTGTGCGNNAGACACGGCAGCCTCCGCCTT
ACAACTTGTGTTTACGGCCAAATAATGCACAGCACTGTGTAGCTACTGGTAAAAGNGGTTTCCTTCACAGCACCTGTNNN
AAAACCCTCATAAACACTACCGAAACGAGGCAGTAGGCACTAGT
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114338144..114338748 585
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es