Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P131D11
Clone ID P131D11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P131D11
Sequence
CTTCCGCAGGCCGTTTCCACCGAGGAAAAGGAATCGTATCGTATGTCCGCTATCCAGAACCTCCACTCTTTCG
Sequence Type mRNA
Unitrap ID UNI1183

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100181402..100181474 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035530 (Eif1) NM_011508 eukaryotic translation initiation factor 1 Gene [Source:MGI (curated);Acc:Eif1-001]


SPLK-Sequence tag 5SP131D11
Sequence
GGTCTCTCCAGCACGTGATCAGCCTTGGCGGGAGGGCTGGCCTAGAGCAGAAAGCTAGCTCTAGTACTGGCCAGTTCCGG
AGGGACAACAAAG
Sequence Type genomic DNA
Unitrap ID UNI1183

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100181860..100181953 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035530 (Eif1) NM_011508 eukaryotic translation initiation factor 1 Gene [Source:MGI (curated);Acc:Eif1-001]


SPLK-Sequence tag 3SP131D11
Sequence
ATTATTTCTTCACAGACCCCTTTGCTGATGCAGTAAGGGTGATGACCTGCTTCCTGCTGGCACTGAGGATTATATCCATA
TAAGAATTCAACAGAGAAACGGCAGGAAGACCCTTACCACTGTCCAAGGGATCGCTGATGATTACGATAAAAAGAAACTA
GTGAAGGCGTTTAAGAAGGTGGGTCTGCTGTGGAGAGAGCACGCTGTATGGGCTACCAAGGGAGAGGGTGCAAACGTCAA
GGGAGTCCGTGTTGATGGCATGGCCTCTTAGATGCTGCATCCTTTTGTCCTTGCAGAAATTTGCCTGCAATGGTACTGTA
ATTGAGCATCCAGAATATGGAGAAGTAATTCAGCTACAGGGTGACCAGCGCAAGAACATATGCCAGTTCCTGATAGAGGT
GAGTTTAGGCCGCCCTCAATGCATTATGNNATTCCTGAATTTCTAATCCTTACAGATGAGCTTTTAAATACATGTAGACA
TTCCCACTTTCAAACAGTACTTGGGGGTGGCATAGGGAAGTTTTAGTAACAGTNNNCAATTGAACCATTGTGTCTACTGG
GATAGACTGAAGTACTCTTCTTTATTGGGACTCCTTGCAAGGTGTATATGGGAGAATCTGTTGACGTCATGTAACCTGTC
CCTCTCCCTTGTCCTCTTTTTGCAGATTGGGCTGGCTAAGGACGATCAGCTGAAGGTTCATGGGTTTTAAGAGCT
Sequence Type genomic DNA
Unitrap ID UNI1183

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100181965..100182680 692
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035530 (Eif1) NM_011508 eukaryotic translation initiation factor 1 Gene [Source:MGI (curated);Acc:Eif1-001]

 
Come back to gene ENSMUSG00000035530


For any suggestions or comments, please send an email to unitrap@crg.es