Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0065
Clone ID CC0065
Vector pGT0lxfT2
Project sanger

Sequence tag CC0065
Sequence
AGGAATGTGAAGATTTTTTTTTTTTTTTAGGGTTTCCCGGGGGCGGATATTTTTGCCCCCGGGGAAGAAGTTGAATTTTT
TTTTTTTTTTTCTTCCCTAACTCTTATTTGATAAGTGGAGGATGAAAGTGACAGTGGTCCTGATCTTGCAAGGGGTAAAG
GAAATGTAGAAACTAGTTCTGAAGATGAAGATGATTTGGCAGATTTGTTTCCCGAAGAACCTGGTTTTGAACATGCTTGG
AGAGAGTTAGATAAAGACGCTCCTCGGGCTGATGAGATTACACGTCGACTAGCAGTTTGTAACATGGACTGGGATAGATT
AAAGGCGAAAGATTTGCTGGCTCTGTTCAACTCATTTAAGCCCAAAGGAGGAGTTGTATTTTCTGTGAAG
Sequence Type mRNA
Unitrap ID UNI1134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 139986119..139990104 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045624 (Esf1) NM_001081090 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Esf1-001]

 
Come back to gene ENSMUSG00000045624


For any suggestions or comments, please send an email to unitrap@crg.es