Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB730
Clone ID XB730
Vector pGT0pfs
Project baygenomics

Sequence tag XB730
Sequence
CTTTCCGAGGTCCTCTGCCGCGTGTTTGGAAGTTATGGCCGCGCGGGTCCGTGGTGTTCTCCCTGAAAGGCCTAAGCTTT
GGGTGATG
Sequence Type mRNA
Unitrap ID UNI9840

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116532983..116533070 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020812 (1810032O08Rik) RIKEN cDNA 1810032O08 gene Gene [Source:MGI Symbol;Acc:MGI:1913543]

 
Come back to gene ENSMUSG00000020812


For any suggestions or comments, please send an email to unitrap@crg.es