Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P127H07
Clone ID P127H07
Vector ROSAbetageo+2
Project ggtc

Sequence tag P127H07
Sequence
ACCTCCTAGAGAAGGAACTCTCAGCTCCTCATATNNNTTTTCTATCTGACCCCTACGCCTGCGCCTCTAGGCGGGCCAGA
CATCAGAACACCCTAGAAGGCGTGGCTGAAAGGATGCTCATGTTTGATCCAGTCCCTGTCAAGCAGGAGGCCATGGACCC
TGTCTCGGTG
Sequence Type mRNA
Unitrap ID UNI2083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65189199..65208069 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]


SPLK-Sequence tag 5SP127H07
Sequence
AATTCTCCTTTGTGTGCTGGTGGTCACATGACACAGCATTTCACTCTAGTTCCAGAAGTTAGCTTTAGTCCTCACTGTGA
AGGAAGTAAAAAGACCTCCTCTGTTTGTGCTGTCAGCTCTTCAAATGTCGTTTCCCTCACCCTGATAGAAAGGACTGGAG
GAGTCAGAACGCACGTGCTAACAGCAGCATAGGACATTTGTAAGTTTGTTTTTTGTTTCATTGGAGAGAGAGCCTTGCTG
TGTATCCCATACTGC
Sequence Type genomic DNA
Unitrap ID UNI2083

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65209748..65210002 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]


SPLK-Sequence tag 3SP127H07
Sequence
TGTGTGTGCCCACGTGCGTGGTGTCGCTTCTTTATCTTTAAAATAAAATTAAAAACCCCTACCCAAAGCACGCGCTTTAT
GTGATATTTTGTGACGTGGTAAAAAAAACCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es