Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB737
Clone ID XB737
Vector pGT0pfs
Project baygenomics

Sequence tag XB737
Sequence
AGTTAGGGACAGAAGCAACAATGAGGACATTTGACCTGACTGCGGTGTCCTATTTGAGGAAAATCAGCTTGGATTACCAT
GACATTAAAGGATCCAGAAAGAACGCCAATTCACTTGATTAGCTCTTCAGACAGACCTGGACTAGATCTTTTAAAAGTGG
AGTACATTAAG
Sequence Type mRNA
Unitrap ID UNI10165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67753664..67755878 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035284 (Vps13c) NM_177184 vacuolar protein sorting 13C (yeast) Gene [Source:MGI Symbol;Acc:MGI:2444207]

 
Come back to gene ENSMUSG00000035284


For any suggestions or comments, please send an email to unitrap@crg.es