Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P127G03
Clone ID P127G03
Vector ROSAbetageo+2
Project ggtc

Sequence tag P127G03
Sequence
GCCACACCCATCCCCTACACACACCCACACAACACCCANNAACCCCCATCNNCAAANNCAACAACCCCCCCAGAGACTCA
CACCAATCTCCCACCCCCCAGCAACAGACACGCNNAANNACGCACCAANNAGCTACANNACGANNNAACCGCCACCAACA
CCGAGAACACACCCCGCACCCACCGCGAACCCAAGNNATGCCCCANNCACCNNCGCNNAAACCGCAACCNNACCTTCCCC
CATGGCTAACCAGCCGATGAGACACCAAATACTGGACACCACCTTAACGAAATAAANNCNNAANNTGCAATATTGTAAAA
TCCANNGAGGCGAGAGCTGTATGACAGATATGGAGAACAAGCCCTACGGGAAGGCAGCGGCGGAGGCGGTGGAATGGATG
ATATCTTCTCACATATTTTTGGTGGAGGATTGTTTGGCTTTATGGGCAATCAGAGTAGAAGTCGAAATGGCAGAAGAAGA
GGCGAGGACATGATGCATCCACTAAAAGTATCTTTAGAAGACCTGTGCAATGGCAAGACAACCAAACTACAACTTAGCAA
GAATGTGCTCTGTAGTGCATGCAGTGGCCAAGGTGGGAAGTCTGGAGCTGTTCAGAAATGCAGCGCTTGTCGGGGTCGAG
GTGTGCGCATTATGATCAGACAGCTGGCTCCAGGAATGGTGCAGCAGATGCAGTCCGTGTGCTCCGACTGTAATGGAGAA
G
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP127G03
Sequence
AATTTTGCCTTACCAACACTGGATAGTAAACCCAAATCCTTGAGTGTGCTTGGCAAGTATTGAACTAT
Sequence Type genomic DNA
Unitrap ID UNI29505

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 88071596..88071663 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031701 (Dnaja2) NM_019794 DnaJ (Hsp40) homolog, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1931882]


SPLK-Sequence tag 3SP127G03
Sequence
CACTGCCTACACCTACCCTAGCCCTGGTGGGAGGGATTAAATCTAGGATCCTTACCACTGAGCCACGTCCCCCATTCTTT
CCTTTGCTTGATGGTTAATTAGTATAGTTGTAGAACTTCACTTTTCCACTTAGTTCTTGGAAATGATGAGGTCATTTTAA
TAAGGTATATATT
Sequence Type genomic DNA
Unitrap ID UNI29505

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 88071394..88071566 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031701 (Dnaja2) NM_019794 DnaJ (Hsp40) homolog, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:1931882]

 
Come back to gene ENSMUSG00000031701


For any suggestions or comments, please send an email to unitrap@crg.es