Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P127F10
Clone ID P127F10
Vector ROSAbetageo+2
Project ggtc

Sequence tag P127F10
Sequence
TGAGGGCGAGGGTCGCGGCGTAGAACCGGACGGGTGGCTCTCTTTGCAGCTCGCGGAGGCGAACCGGGCGGCAG
Sequence Type mRNA
Unitrap ID UNI10950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86239171..86239236 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005481 (Ddx39) NM_197982 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI (curated);Acc:Ddx39-001]


SPLK-Sequence tag 5SP127F10
Sequence
AATTCATTTTTAATATATTCTAGCATTTGGGAAGTGGAGG
Sequence Type genomic DNA
Unitrap ID UNI15525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86240411..86240450 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005481 (Ddx39) NM_197982 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI (curated);Acc:Ddx39-001]

 
Come back to gene ENSMUSG00000005481


For any suggestions or comments, please send an email to unitrap@crg.es