Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P126F07
Clone ID P126F07
Vector ROSAbetageo+2
Project ggtc

Sequence tag P126F07
Sequence
CTAAAATTTCCCAACTCCAGGAATTGGTGGCGGAGAGGGGGCAAGTCACCAGGGCTCTTCCCGGCGCCCCAATGCGCGCA
CCATGTCGAGGCGCAAGCAGGCGAAGCCCCAGCACATCAACTGGGAGGAGGGCCAGGGCGAGCAGCCTCAGCAGCTACCG
AGCCCCGACCTCGCCGAGGCGCTGGCGGCGGAGGAACCCG
Sequence Type mRNA
Unitrap ID UNI1046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168592412..168592611 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]


SPLK-Sequence tag 5SP126F07
Sequence
AATTTTGGCAGGATTCAGTACGAGGAAGCTCGGCGTTGCATTCTGGGTGTAACCTTGCCTAGGTGGACTAGTGTACCCCC
ACTTATTCACCCAGCTTTTTGGGTCCTTGTGTACAGTGGCAGTGAAAAAGTTTTCTATAGACTCCTTGCATGTTGAGG
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168589661..168589818 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]


SPLK-Sequence tag 3SP126F07
Sequence
AGTTTTCACTGGAACCTGCTATGTGGCAGGCTCCAGCCTGGGACCTCGAAGGACCTCACCGTTAATTCTCACAACCTGAA
GTAGTTTTGGTATTTCGCTCCCTTGAATAAAGGCTCCCGGGTGGCAAGGGTCGCCCAGTGGTTCCCCTCCCACTTGACTT
TAGCCTTCTTGAATCCATGGGGTGTTTGTTGTTGGTTCTAGAGCAAGGGGGATGTACTCATTAGTAAGGGACAGCCTAGC
CATGGTGCTTGAAGCTGCTTTGGTTTGGTGACACCCCCCCCCCAGTCTGTCTGGGTAGAAACCATGACAGTTTTCTAACC
TGTCCCAGCCTTGTCACGCTCTTGTCTTTGCCTCTGAAGCTGAAATTGGAGGAATGTGCCGCTAAATCCAGGGCCCATTT
GATTTTTCAAATTGCCTTTTAAAAACTGGGGGGGATGAAACTTCCCAGCAAGCAACTCAAGAGCTAACGTCATTTGGGTT
TCTTTCTTGGGGTTACGGGATTTTGA
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168589133..168589639 483
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es