Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CC0064
Clone ID CC0064
Vector pGT0lxfT2
Project sanger

Sequence tag CC0064
Sequence
CAGTGGGAAGTTAGAGTGTCCCTNTGATACAGCAGTTCAGTTGGCAGCTTATAATCTGCAAGCTGAACTTGGCGACTATG
ATCTTGCTGAACATAGTCCNTGAACTGGTCTCTGAGTTCAGGTTTGTGCCCATCCAGACTGAAGAGATGGAACTGGCTAT
TTTTGAGAAATGGAAGGAATACAGAGGTCAGACACCAGCACAAGCAGAAACCAATTACCTGAATAAAGCCAAATGGCTAG
AAATGTATGGTGTTGATATGCACGTGGTCAAGGCTAGAGATGGCAATGACTATAGTTTGGGACTGACTCCAACAGGAGTC
CTTGTTTTTGAAGGAGAGACCAAAATTGGCTTGTTTTTCTGGCCCAAGATAACCAGATTGGATTTTAAGAAGAATAAGTT
AACTCTAGTGGTTGTGGAAGATGATGATCAG
Sequence Type mRNA
Unitrap ID UNI1135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 121511923..121516796 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026383 (Epb4.1l5) NM_145506 erythrocyte protein band 4.1-like 5 Gene [Source:MGI Symbol;Acc:MGI:103006]

 
Come back to gene ENSMUSG00000026383


For any suggestions or comments, please send an email to unitrap@crg.es