Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P126D08
Clone ID P126D08
Vector ROSAbetageo+2
Project ggtc

Sequence tag P126D08
Sequence
CTGCTNNNCTCGCGAGGACGGACGCCATTATCGCAGCTCCCCGACAAACACCACGAGAATTCCGCAGCCCACACG
Sequence Type mRNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124474474..124474548 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]


SPLK-Sequence tag 5SP126D08
Sequence
TGAAATGTAATAATGTTAATTTTTGTGGGGCTGGCATAATTGTATGTACTAATGAGGCACGGTGTGACTTTTCCACACAG
TGTACTGTCAGCACTGGCCAGCCTAGGGTAAACGGGTTCACCTTACCAGTGGGTTCTCAGTGGCAATGCTGATGTCATAC
TGGTATCTGTGTCTGGCATGAACATTGGCCCTGTATCAGCTGCAGGATGCCTTGGAGAGGGCCGTTCAGTTGCTCACAGG
CTCTCAGCTTTCAGCAGTGCCTGGGAGGCAGATGCTTAGCAAAGCAGATCTTTATGAAGTATAGTAAGCCAGAGGAAAGT
GCTTGTCCATAAAGCAGGACCCGAGACCAGGGGGGTGGGTGCTGGTGTCCTTCAGACATGATTTAGTGTCAGCGAAGAAC
CTGTGTGGGAACAGAAAACACGTGGGAAAGGGTGAAGGGGCCGTCTGACTGGAAGAGACAAGGCTGGGGG
Sequence Type genomic DNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124489999..124490468 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es