Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P126C12
Clone ID P126C12
Vector ROSAbetageo+2
Project ggtc

SPLK-Sequence tag 5SP126C12
Sequence
AATTTTTTGCGCCCTTAACTTCCACACATTCCCAGATTTGATGCACTGTAATCTAGAGCACCGTTCAATAGGTTAGCCTC
CTCTGATTCCCATGCTTACCTGAGATTAACATGCGGGTCCTGGTTTTGGTTTGTTTTTTTCCCCTTGGATGCCACTGAAT
GAGACCGACTCCATTAGGTAAATTGCTTCTTCTGAAAGAGTTCCTGGCAGGGCAGATTCACTTCAAAAGGATTTTATAAG
CTATTTTGTCTGACTGCCTTGACTGTAGCCGCCCTAGTTCACCAAGGTACTACCAAACTAACTCCTTAAAGTTACTGA
Sequence Type genomic DNA
Unitrap ID UNI17223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31273288..31273604 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047714 (Ppp1r2) NM_025800 protein phosphatase 1, regulatory (inhibitor) subunit 2 Gene [Source:MGI (curated);Acc:Ppp1r2-001]


SPLK-Sequence tag 3SP126C12
Sequence
AAAGATAAGCCTTTTCTAATCAACTGTTGAAAAATTGTAAAGCAAAGAAATTATAGCAATAACACTACGTTATTGTATAT
ATGTAGTTGCATATACAAGTCCCTCGGTTTGATCCCCAACATGCAAAGGGAAGGGAAAGGAAGACACGCACTGTATAAAG
TATGTGACGTACATGTATCAGAAGGTCAATGCAACTCATCCTTTAGTACACAGAGTTCAGGGATGTATGTTAGTAGTTAT
AACTGTAATAGTGTGAGAGCTGCAAACAGCGAGCAGAGCCTTGCCACAGTGGGCCCCGCCGACAACAATTAAAACCTCTC
CTACTCTGCTGATGGCTTTGAGCATTCACTAAAGTACCTTCAGTATTGGAGTTTAGATTATAGAAGGATTCCAGGAAGGA
Sequence Type genomic DNA
Unitrap ID UNI17223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31272866..31273266 397
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047714 (Ppp1r2) NM_025800 protein phosphatase 1, regulatory (inhibitor) subunit 2 Gene [Source:MGI (curated);Acc:Ppp1r2-001]

 
Come back to gene ENSMUSG00000047714


For any suggestions or comments, please send an email to unitrap@crg.es