Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P125H10
Clone ID P125H10
Vector ROSAbetageo+2
Project ggtc

SPLK-Sequence tag 3SP125H10
Sequence
AGAAATGTGGGCATATTTTTTAATTCTAGTCAATATTTGTACAAGAAATATTTGCATAATTAGAAGGCTTTGACCTACCA
ATTCTCCAGAAAGACTGGTCCAGCCACCTCTTTGTCCTGTATTCTCTACTATAAAAG
Sequence Type genomic DNA
Unitrap ID UNI5812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127474932..127475068 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es