Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P125H06
Clone ID P125H06
Vector ROSAbetageo+2
Project ggtc

Sequence tag P125H06
Sequence
TTTCTTTTTTCCACCACCCTTGGTTCAGGGGTGGGTNNGTCTCCTTTCTGCCCCCTTCTTGGTTCCGTGTTCTCCGCACA
AAATGCCCGGTGAAGCCACAGANNNCGTCNNTGCTACCAGAGCAGGGAGTTGCNNNACCTCAGGCTGAGACAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP125H06
Sequence
AATTTTTATCATTACTCATGGGAGTTTGTGTTTTCTTTTGGAATTAAAGTTATTTATATTTAAAAGCATTAAAGTCCTCC
CTCCCCACCTGTCTTGATTTTAGCAGCCGAAGGGATTAATCCAGCTGTTAGACTAAAAAGGAGGTGGGACCCTGAGCTGG
GAACTGGATGGTGTAGAGAAGGAATGGTTTCTGGGGATCTGCAGAGCTCAACAGAGTTAAACTATCTTACAAATGTGGAA
GCTGAAAGTGGATTTAGAATATCCTGATCTAAAGCATAAAGCAGTCCTTATTGTTGCTAAAGATATTCCTAATTAGTCTG
AACTTGTATTGAGGATATACCTATAATGTCTGTAACTATTCTTACTGAAATGAATGAAAACAATCAGTATATTGGTT
Sequence Type genomic DNA
Unitrap ID UNI5812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127474521..127474917 397
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]


SPLK-Sequence tag 3SP125H06
Sequence
AGAAATGTGGGCATATTTTTTAATTCTAGTCAATATTTGTACAAGAAATATTTGCATAATTAGAAGGCTTTGACCTACCA
ATTCTCCAGAAAGACTGGTCCAGCCACCTCTTTGTCCTGTATTCTCTACTATAAAAG
Sequence Type genomic DNA
Unitrap ID UNI5812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127474932..127475068 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es