Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P125F08
Clone ID P125F08
Vector ROSAbetageo+2
Project ggtc

SPLK-Sequence tag 5SP125F08
Sequence
AAACCAAGCATCATGTTTTCTTATAGGTAAACATGTAG
Sequence Type genomic DNA
Unitrap ID UNI12184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13183489..13183526 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060475 (Wtap) NP_001107005 Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]


SPLK-Sequence tag 3SP125F08
Sequence
GACATTTTTGAGGTGGCTAGGTTTCACTCATTCATTCACTACTGCTGGGGCAAGTTAGGGGAGGTTGCAGTCTACAGGAT
GGCTTCTGATATGATTGAAACTG
Sequence Type genomic DNA
Unitrap ID UNI12184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13183363..13183465 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060475 (Wtap) NP_001107005 Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]

 
Come back to gene ENSMUSG00000060475


For any suggestions or comments, please send an email to unitrap@crg.es