Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P125C08
Clone ID P125C08
Vector ROSAbetageo+2
Project ggtc

Sequence tag P125C08
Sequence
CCAAGGAAGTAACCCTTTTCAGGGGGCCTTTCTCAAGGGGTTGCCTGCCACACTTTTTTTTCCTAAGAAGGGGGCTCCCC
AGCCCCAAAAAAAGAAAACGGGAACNCTNNNAGCTTTTCCTCGCCNNNNCAGGTAGGGGACTCTCCTGTTCCAAAAAATC
CGGGGCCCCCCAAAACGCCCCAATGGAGGGGNNAAGATTTGCCACGGCCCCCCCCGCCNNCGGGTTAAGGGGTCCCAAAA
AAGAAGACAGCTTTCCAACCCCCTTTTCCCTNTNNNNTCCNNNNAGGCAAAAAACCAGCCATTTCTAAAAAAGAGGGAGA
AAACTTTGGAAGCTTTTTTCCAACGGTGTGTTTGAGGCCCACCCTCGGCAAGTCCCAAGTTTCGGGAGCCACAGGGCTCT
GAAGAAACCCCTGAAAACGGAGGACGACTTTGGAAATTTGACCCTCGTTCCTTACAAAACCCCTGTCTCCAGGAAAACCA
AGAAAANCNNNTTCACCCGTCCCCAANNNCCTGCTGGCCAGCTGAATAAAACACCCTCCAGTTCCAAGAAAGTCACCTTT
GGATTGAACAGAAACATGACTGCAG
Sequence Type mRNA
Unitrap ID UNI10863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32194035..32196282 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058392 (Rrp1b) NM_028244 ribosomal RNA processing 1 homolog B (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rrp1b-001]


SPLK-Sequence tag 5SP125C08
Sequence
ATTTCCATGTAGCCCTGGCTGGGCTGTGAGCTCCTCAAACTCACAGAGCTCTACCCGCCTCTGCCTCCTGAGTGTTAAGA
TTAAAGGTTGGGAAAGATTTCTTGGGATCTTCTTA
Sequence Type genomic DNA
Unitrap ID UNI10863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32196529..32196643 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058392 (Rrp1b) NM_028244 ribosomal RNA processing 1 homolog B (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rrp1b-001]


SPLK-Sequence tag 3SP125C08
Sequence
AGTTCTGTCTCGAGGCTGAGAAACCCTTGTTCCTTAGCTATAGCTGCCCCAGCTGTAGCCACACTGCCTACTACATAGTG
GACCACTCTTACTGTTAAATCAAAGAAACCAAATGGCCCTTGTAAGAAGGTGG
Sequence Type genomic DNA
Unitrap ID UNI10863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32196662..32196795 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058392 (Rrp1b) NM_028244 ribosomal RNA processing 1 homolog B (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rrp1b-001]

 
Come back to gene ENSMUSG00000058392


For any suggestions or comments, please send an email to unitrap@crg.es