Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P124G07
Clone ID P124G07
Vector ROSAbetageo+2
Project ggtc

Sequence tag P124G07
Sequence
CGGGACGAGACTCTTCTGTGTGTGCGAGCGCGGAGGCTGCGTGCTGGTCANNTCNNGCCGCCTNNNGCCTGCGGAGCTCC
AGAGCTCGAACCCCAGCCCTGGAAACCCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP124G07
Sequence
ACTCACATATTTACCACACTTAGGCTTTACCCTCTCAACCAGGGCAGAGAAAGGAGGCTGGGACCTGACCTGTGCCAC
Sequence Type genomic DNA
Unitrap ID UNI7354

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103222836..103222914 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033792 (Atp7a) NM_009726 ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI (curated);Acc:Atp7a-002]

 
Come back to gene ENSMUSG00000033792


For any suggestions or comments, please send an email to unitrap@crg.es