Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P124G05
Clone ID P124G05
Vector ROSAbetageo+2
Project ggtc

Sequence tag P124G05
Sequence
ACCGCAACAACCCCACCACACTATCCCACAANNAANNTCAATCAAGACAGANNCCGNNGCCGAACTCTAATTCTGCCAAC
TCCANNTNACTTTGACTTCCCATTCCGCACACCCCAGAAGATCTCTCCAGGGAATTTTTTGGTGGAAGGGACCCATTTTC
ATTTGACTTCTCTCAAGACCCATTTGATCACTTTTTTGGAAACCGAAGGGGTCCCCGAGGAAATAGAAGCCGAGGTGCCG
GCTCATTTTTCTCTACCTTCAGTGGATTTCCTTCTTTTGGAAGTGGATTTCCTGCTTTTGATACAGGCTTCACTCCATTT
GGGTCACTAGGTCATGGGGGTCTCACTTCATTTTCTTCAACGTCATTTGGCGGCAGTGGAATGGGCAACTTCAAATCAAT
ATCNNNTTCNNNTAAGATAGTTAATGGCAAAAAAATCACGACAAAGAGGATTGTGGAGAACGGTCAAGAAAGAGTAGAAG
TTGAAGAAGATGGGCAGTTAAAGTCCTTGACAATAAATG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP124G05
Sequence
TGCCTCCTCTGTGTATTTTGAAATAATCTTAAGTGCTCAGTCTAGTCTTGCACTTGAGATCTCTGTTCCTTCACCTCAAG
TGCTCCACCAGGCTTCATTATTACAGATTTTAGTTTAACATTTGTGTGAGGAAAGGAACTGGTTCTAATGTTTTCACCGA
AAAGTATTTTGAAGACTTTTTTTTAGGGATATAGTTTACAGAAGATCAATTCAGGGCAGGGCATTGTGCATGGGACATCA
AGGTATGATTAAAGAGCCAGTAAACAAACTTACTTCCCTCTGCAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI29510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30093965..30094253 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


SPLK-Sequence tag 3SP124G05
Sequence
GTTACATCGNGATATGAAGTTCTAACTAAAGGTCAGTTATGTGATATTACACTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es