Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P124F12
Clone ID P124F12
Vector ROSAbetageo+2
Project ggtc

Sequence tag P124F12
Sequence
AGAGACAAAGAGAGCAGAAAAAGAAAAAAGAAAACCCAGACCGCAACAAAACACAAAGACAAACCACGAAGAAACACAGA
CGACAACCAAAAGAAAAGGCAAAAGCGAAGACAAACAGAAACGGCAACCACAACAGAAGGAGGAACCAAAAACACACAAG
CACAAAAAACCAAGNNANNGCAAAAAGCGAGAANNCACCCACAAGACAGCAGANAACNNCCGAACACAAAGAGCCAAAAN
NNGACAGAGCACCAACGAGAGACAACAAAAACACACGAAGAGCANNGCACACCGANNCNNAAAAAGCANNCAGACACAAA
ACGGAAAAACCAACAACCAGCGCCAGACAAAACAGAAAAAACAACAACAAAGAGCGAGAACCACAAGGACAAGAACAAAA
GCCCNANNCAACNNNNACACACCAACGAAGACACGACAAAANNAACACCAAACACACAGAAGCAACNNAAACCCCGAGAC
AAACAAAAACACCCCAAGACNNACAAAACGAACNNGAGAGAGCCAAAAGCAAACNNAGAGAACAAACCACAACACGAAGC
AAAAAGCCACCAACAACNNNNAAGACACCAGCCAACCAAAAGCACAAACAAGGCAGAGGCCCCCGAAAACAAAANNNAAC
ATACAACACANNACCCTCANACAACAGGGGGGAGGNNAGGGCGGGTTTAAACCGGGCCGGGGACGCCGTAAGAACGGCGC
TTGAGGGCTGGANNGGTTCCGCGGCTGCCGGGTCAGCACCATGAGCTCCATCGGCACTGGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP124F12
Sequence
TGAGGATTTCGAGCTGGACTTTAATTTGTTGAGGCTAAATACACCCANNNNGTGCAGCGATTTACCCCACCTTTCCTTTG
TCTCCATATAGAACTACTTAACAGTCTCGATTATTTGCAGTAGAGGTAATGAATGAATAATGCGTTTCTTGGTTATCCTT
GTTTCCCCCATTATTTTGATGCTCACCAAGT
Sequence Type genomic DNA
Unitrap ID UNI443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72076359..72076550 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060073 (Psma3) NM_011184 proteasome (prosome, macropain) subunit, alpha type 3 Gene [Source:MGI Symbol;Acc:MGI:104883]

 
Come back to gene ENSMUSG00000060073


For any suggestions or comments, please send an email to unitrap@crg.es