Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P124D07
Clone ID P124D07
Vector ROSAbetageo+2
Project ggtc

SPLK-Sequence tag 5SP124D07
Sequence
AATTCTGTTCAGGTCAACAGTGGAAGAGTGAGGTGGGTGAGTCCTTGGGTGGTGTGAAAAGTGGGCACCCTTCCAAGGTA
GGTGCCAGCCCCGCTAAGCAAGCCTGGCTTAGGGTGCCTGCCCCTCTGCGTTTCTGGTCAGGCCATTGCATGGTACTTCC
TGTAGTACCGGTCACAGGGAGCGCTCAGAAAGTTTGCTAAGGAAATGTAAAGAAAGGGTTCTCGACAAAGGAAGTTCAGC
TCCAGGGACGGCGCTTGCCCTCCTGG
Sequence Type genomic DNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65203711..65203976 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]


SPLK-Sequence tag 3SP124D07
Sequence
AGGGTGGGGACTAGCANNNATACTTACTTCCTCTTTTGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es