Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P124B11
Clone ID P124B11
Vector ROSAbetageo+2
Project ggtc

Sequence tag P124B11
Sequence
GGTTGGCGCGGTCTCCATCACAGCGGCGACCGCTCCTGTTGCAGCTGTAGCTCTNNTCCTTCGGTCCCTTCCCGCCAGGT
CCCGGAGTTTCGCCCGCCATGGCTCTACTCACTGCAGCAACCCCGCTCTTGGGANNCAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP124B11
Sequence
TACAAGGCCACTGCATTTTTAAAGAAACAAGTATTATACAGACAAGTACTTAGACACAAATCAGTGTCTTGCATGCTTTA
CA
Sequence Type genomic DNA
Unitrap ID UNI4248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127782868..127782949 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005683 (Cs) NM_026444 citrate synthase Gene [Source:MGI Symbol;Acc:MGI:88529]


SPLK-Sequence tag 3SP124B11
Sequence
TCCTGCATTCCTTCATACAAATTATCTCCTGTAGTTTATTTAACTTTCTGAAAGTGGCTCCTTGTGTGTGGTGCATACTA
Sequence Type genomic DNA
Unitrap ID UNI4248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127783295..127783374 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005683 (Cs) NM_026444 citrate synthase Gene [Source:MGI Symbol;Acc:MGI:88529]

 
Come back to gene ENSMUSG00000005683


For any suggestions or comments, please send an email to unitrap@crg.es