Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P123H01
Clone ID P123H01
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP123H01
Sequence
ACAGTACCTGATGAGTCTATAGTTGAAAGAACTAATCTAAGAGGGAATGTTAAGGGGGCATTTTGGTTTATTGTGTTAAG
TATTAGAGGAGGCTTCTGGGCCAGACAGATAGGCTCTAGTGTGTTTGTATGATGTTTGTCATTTGTCATGTTAATATTTG
GGTGAATATTCAAAAGAATAGTGTTGCATACTGGCAAAAGGAAAAGGAGGGACTGAAGACCCAAGGACAGATGTAATCAG
TTGGTAAGAAATTTTGTCAGGGTAAATGATTTGGTTTTGGACTGGG
Sequence Type genomic DNA
Unitrap ID UNI19789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74551375..74551660 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033364 (Usp37) NM_176972 ubiquitin specific peptidase 37 Gene [Source:MGI Symbol;Acc:MGI:2442483]


SPLK-Sequence tag 3SP123H01
Sequence
CATTTCTCTCTAGCTTTAATTCTGCTATATGTTGATAACTTGAGATTTTCTTATTTTCAGCTCCATATTCAAATAGCCAA
CTGTCTGCTTAACATCTCAACTTGATTTTTTCTCCCCTTAGGAATTTCAAATATACCTTTAAAAACTGGAGTCAATCTGT
CTCTTGTACCCAAATTCTCTCCTTTCCAGTGTCCACTACACCACAAGCGGCATGCATGTCCATTTTGATGACACATAGCC
ATTTGTTCAGTGACACTGGGTAGAAGCTTGAGAAGCAGTCTTGATTTCTTCATCCTATGTGTTCATATCCTTTCCAAGTT
CTGTTTTACTTCTAATATATGTTTTGCATTTATTTCTGACCTTCTTCACTTTGACTTTTCTAATTCAAACCACAGTTCTT
TTTCATAGGGACTTGATCTCCCTTATTCCTATTCTCACCTGTAGAATAGGAGTAAGAGTTCTTAGCTTACCTGGGTAATG
GGAGGCAGGGGCAGATGG
Sequence Type genomic DNA
Unitrap ID UNI19789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74550852..74551354 481
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033364 (Usp37) NM_176972 ubiquitin specific peptidase 37 Gene [Source:MGI Symbol;Acc:MGI:2442483]

 
Come back to gene ENSMUSG00000033364


For any suggestions or comments, please send an email to unitrap@crg.es