Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P123D06
Clone ID P123D06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP123D06
Sequence
GATCTGTGGCCGAAGGACCGTCACCACATAACTTCAAAAATAATCAACCACCTTCCCTGCCCAAACCTACCCAATCTCAC
TCATCCAGCATTTCCGTTTTGGAATCCACTCAGACTTTTTTTTTCAACGACCCCCTCTCCCTAAATGGAGTTGGGCGGGG
GGGAAATGAAAACTGAGTTGGTCTTTACTTTTTTTAAAAGAGACTTTTTGATCCAATGAGGCCCCACAAGTAACTGAGTT
TGGGTCCTGGTTGGTTGCTTTATTTTTTTTCCTCCAAAATTTTACCCCTCCCCCCTGAGCCCGAGGTGCTGACGTCGCAA
AAAAATTGGATAGTAAGTGTCGAATTTTCAAAAACCAGCCTTGAACAAGAAATCAACGTTTCCCGTTGTGAAACCAAAAA
TAATGAGAGGAAGAAATGAGACCATAGAACAAATGTAGAGTACTGGAGAGAAGGACCAATCGGGTCTCTTAAATCTCCAT
TAAAGGT
Sequence Type genomic DNA
Unitrap ID UNI15043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054330..36054816 487
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]


SPLK-Sequence tag 3SP123D06
Sequence
CTAAACANNCTTTGTTCTCTCTCCCCTACCACCTGCCTCTTCCCTGCTGTGGAGCNNNCAAGNNNAGAGTGAAGAAGGGA
GGGCCAGCCAGTGAGGATTTTGACGGTTAACCCTTGATAATCCAGCAGATTTCCAGACTGCCAGAGCATAAGCCTTTGCG
ATAATAAGGAGGAATGGTTACCTTCCTCTGGTTAGCAGTCTTCAAAAGGGTTAATGAGCTCACATACAAAAGATGGTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es