Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P121F04
Clone ID P121F04
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP121F04
Sequence
GATCTCTAATTTCTTTCCTTCCCTTTGGCTATAAAGGACACAGTTCAGACACAGGT
Sequence Type genomic DNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88375537..88375592 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]


SPLK-Sequence tag 3SP121F04
Sequence
ATTATTTCTATATTTTTTAAAATTACCTGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000005370


For any suggestions or comments, please send an email to unitrap@crg.es