Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB857
Clone ID XB857
Vector pGT0pfs
Project baygenomics

Sequence tag XB857
Sequence
GAGCCCCACTGCTTCGACTTCTGCGGCCGCCACTGCCGCCGCCTCGGGAGAGAGGAAGCGGGAGAGGAGCCCACGTCGCC
TGTCACCTAGATCCACGCCGCGCCGCCAGGAAGAAAGATGTTCGCCTGCGCCAAGCTCGCCCGCACCCCCGCTCT
Sequence Type mRNA
Unitrap ID UNI9841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 73749013..73749357 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018770 (Atp5g3) NM_175015 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 3 Gene [Source:MGI (curated);Acc:Atp5g3-002]

 
Come back to gene ENSMUSG00000018770


For any suggestions or comments, please send an email to unitrap@crg.es