Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P121E03
Clone ID P121E03
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP121E03
Sequence
GAGAGGAGCGCNNGCTGCTCGCTNGCAAGTAGGNCNNGCAGGTTGGTGGGGACAGAGGGTTTGGGGGAGACTCGGCGGCG
TAAGAGGGGAGGAGAGGCGGTCCAGTTTCGGGGTTCTCTTCCGGGCCTTCTGAGGGGGGGAGTCCCTATTGTTTCCCACT
CGCAGAGCTGGTTCCGGCTCTTGTGGCGCAGATAGGATTGCAGGGCAGAAACCCTTTTGCTTTTTGATCCGAGGGAGCTG
GGTTTGAAGCGAGGGAAGTTGGGGGAGGGGGCGAGGAATTATTGCCTTACGGTTACCGGACTCCGATTCTTGGCTTAGGG
TTTTCCCTTCGCCATAGCCCCCCTTTACCTTCGTAAGAACCCCAATCACTCCTACTTCCTGTTGAGGCGTATAGAAATCG
CCCTGTATTTGCAAACAAAAGCCCTTGTTGGAGCTTATGGGACTGTTTTAGGTGTGAAAACTGTCAATTGCTAACCACGG
TCTGCCCCCTGCTGTAATTAACTCCTCCACCGGCTCCTCCCAACTAAGTCTTATGTTCCT
Sequence Type genomic DNA
Unitrap ID UNI15377

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44413388..44413928 509
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032097 (Ddx6) NM_007841 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]


SPLK-Sequence tag 3SP121E03
Sequence
AATCTAAATTGGGGAGGGGTAGGACGAAAAATTTCCCACTGAGCCATAAAGCTGCAGTGNNNGTNGTCCGTTTCTGGAGG
GAGCAGTTATCGAAGTCTCTGGGTTTAAGGCCCACTAGGGTCGTAATGAGCCTCATTCAGACACATGATGGTGTCGGTTA
GGATTCAGAGGTTGCCCCCTTCATCCTCTTAGTGCTGTACAAACAGTAAGCCTTCCTGTTTGACGGACCTGATACTGTTG
ATCATATGCTGTCAATACAGAAAATACCTATTAAGATAAAAAATAAGCAATTTAATGTGATAGAAGCATTTGTGAGCAAG
TTGATGTATTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032097


For any suggestions or comments, please send an email to unitrap@crg.es