Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P121C07
Clone ID P121C07
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP121C07
Sequence
GTGGAGGCCATTCTTACTCAAGCCAGTGCATCAGGGAAAAAGAAAGTAGCATTTGGGACTGGTTCTTATGCTCATAGAGT
GGGGTACATTCATTTGCAGTTTGGAACAAGTTGGAATAGTTGTAA
Sequence Type genomic DNA
Unitrap ID UNI6252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154294463..154294587 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]


SPLK-Sequence tag 3SP121C07
Sequence
TCACTTTCCTTTTCTCAACTTGTCTGTCTAAAACAACTAAGTGTAACCA
Sequence Type genomic DNA
Unitrap ID UNI6252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154294846..154294894 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es