Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P120E06
Clone ID P120E06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P120E06
Sequence
TTGTCTTCCTCTCCCCGCCAGGNNNCTGAAGGAGNNAGCGCGAGGCAGAGGGAGCCAAGATCGACGCCAGTAAGAACGAG
GAGGATGAAGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP120E06
Sequence
ATCATTCAGGAGACAAGGAAAGGGGGTTCGATCCGGGTCCTTAGATTTTCTTGTTCCCATTACAGATTGCTGATCTTGAG
TTATGGTTTCGATACTTTTTATAGTGGGGCTGTGCGTATGCAATTTTTTTCACTATAACCAGGAGAAAGTTTTGGTGGGG
AGTTTTTAGAAAGGTGTCATTTTAACCCGTGATTTCCACTACTGGTTAAGAGTATAAAATTTGTAGGGGTGTTGGGACAG
TGGAGAAGGACTTGGAGTATAATGTTTAAGAAAATCTCAGTTCAGGCTGATTCTCTGCAGTCTGCTAATGGTTGTACTGG
CTTTAGTGGGGAGTTGAGGGTGGGATGGGAAGTGAATTTAATTAAATGGAACTAATATTGAACG
Sequence Type genomic DNA
Unitrap ID UNI10932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100405915..100406298 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]

 
Come back to gene ENSMUSG00000000568


For any suggestions or comments, please send an email to unitrap@crg.es