Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P120D12
Clone ID P120D12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP120D12
Sequence
GATCTAATTCTCTTCTCTAGTTTAATGAAGGAAGCTTTAAAGGAAGTGTTTGATTTTGACCAAATATGCTATATTGTGAA
AGTTAGCAGGAATACTGC
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70324712..70324809 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


SPLK-Sequence tag 3SP120D12
Sequence
CAAGACTTGTGTACTAGTTAGCTGTGTCTGTGAGAGAGTGTAGAAGCAGAGATACTAGAAGAGTTGTGAGACAGTCAAGT
GGCTAACTCTGCTTAGTCACACTATGTCCTCGAGTGGAAGAATGGATGCTTTATGGATGCTACAGACTCTAGATGGCTGT
CAGCACAGATGTACCTAGTTCTTTAAATGCCTGCCTTGTTTCTCCTAGGCCTTCCCTGAAGTTTCCCATGTCTCAATGGA
CTCCTGAATTTAACGAGCTCTACACCCTAAAAGTGGCTATGAAGAGTGGGACTCCTGATGCGCCCACTACACAGGAGAGT
CTGAAGGCGGTCCTTCTGCACCCACAGCCCCTAGNGCCACCAAGAGCTTCCCTGCAGAAGTGGAGATGATTAATAGCAAA
GTGGGGAATGAATTCTCTCATCTGTGTGATGATTCTCAAAAACAAGAGAAGGACATGACTGGCAACCAGCAAGAACAAGA
AAAAAGTGGTGTTGGGAGAAA
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70324182..70324684 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es