Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P120D04
Clone ID P120D04
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP120D04
Sequence
GTCTTCAGCTGGGGCTCAGTTTTATGGGCTTTACAATAATTTACAAGAACATTATTTTATTCACTTTAATTTGGATGGAG
AATGATCTTTCCATAGAGGGCATTTATAGGTAACCAACTCCTTCCTTCTCAAAGCTTCAACTAGGAAGGTTGGAAAAGGT
AACACTGTCAAAGACTGAATTGAATTGATCAAATCTAGAAGGAAAAGCCCAGAATTATAAAATATATTGTTGCTGATTTG
TACATCCTATCTTTGGTAGCCAATAAAGTATTTAAGGACTCAAGGTAAAGTAAGTCTTTTTAAGTGGTATTAGTTGGTCT
TAACTGGAAATAAACCTCTTTTTATCTTGTTAGCATTCTGCACATGCAAATTGCTAAAGATAAGGGATTTTGCTTATTGA
TGAAAGCTAGGATACAAAAGTGACTGGGACATTTTGGATGTTCTGAATGCCCGTGTGTTTCATTTGGAGGGCTGCAAGAG
GGAACTTTTATCTAAGGATTGCTGGAGAACCTTAGACCACTTAGTAAAATTTCCACTAAATTATTGAATTATTTAAAGGA
ATTTAGACTTTGTCTCCAGAGTTAATCTTTTTTGAGCCAGTTTTGTGATCTTTGTACCAAATTACACTTTCACTTTTGGA
GAGATACAGAAGGCGGCAGTATTTTCAAGTTACACAATTCAGGCTGTTGAAT
Sequence Type genomic DNA
Unitrap ID UNI16468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32418985..32419676 692
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


SPLK-Sequence tag 3SP120D04
Sequence
CACAACAACCTGCTTGGGGATGTTTTTAAAGAAAAGCCATTCTGGCCAGACTATGTGGCTGAAAAGTGTTTGAATGTTTA
GAGTTTGGGAAGATGGTACAGTGAATGCACTGCCTCTTCAGCTCTTGCTGATCTGACACTACCTTCTGAGTTCCTTCCAC
CCATGCATGCTCAGCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es