Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P120D03
Clone ID P120D03
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SP120D03
Sequence
ACTGCCTTTTGGTATTGGATGACTTTCTAATTTATCACTTCTCCATCTGGTATTTAATCTTTTCTATTGGTGTGTTAATG
GAACTTCTTTTATGAAGGAAAGGGCTTCAAACTTCAGGCTTTATAGTGTTGGACTATTTGGGACTTGCTCATTGTAGAAT
TACATAGGTAGGTTAAAAATTGGTTCCGTANNTGCTAATATCTAAAAAGTCAGTTTTACTGATTTCTTTCGTCCTCTA
Sequence Type genomic DNA
Unitrap ID UNI29513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 72813456..72813693 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079286 (AL844840.8)  

 
Come back to gene ENSMUSG00000079286


For any suggestions or comments, please send an email to unitrap@crg.es